1Department of Biology, Science and Research Branch, Islamic Azad University, Tehran, Iran
2Pathology Department, Cancer Institute, Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
3Department of Hematology and Oncology, Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran
© The Korean Society of Pathologists/The Korean Society for Cytopathology
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Ethics Statement
This study was approved by the ethics committee (ID IR.IAU.SRB.REC.1397.110 on October 23, 2017). A consent form was obtained from patients before using their samples in this study.
Availability of Data and Material
The datasets generated or analyzed during the study are available from the corresponding author on reasonable request.
Code Availability
Not applicable.
Author Contributions
Conceptualization: KA, IS, SI, FA, ME. Data curation: KA, IS, SI, FA, ME. Formal analysis: KA, IS, SI, FA, ME. Writing—original draft: KA. Writing—review & editing: KA, IS, SI, FA, ME. Approval of final manuscript: all authors.
Conflicts of Interest
The authors declare that they have no potential conflicts of interest.
Funding Statement
No funding to declare.
The 2R3R genotype was the most frequent (54.0%) among all cases with 5′-UTR–TYMS VNTR, followed by the 2R2R (25.0%) and 3R3R (21.0%) genotypes. In rs2612091, the highest frequency was related to the AG genotype at 48.0%, and the frequencies of AA and GG genotypes were 29.0% and 23.0%, respectively. Genotypes with rs2741171 were 48.0% GG, 16.0% AA, and 36.0% AG.
TYMS, thymidylate synthetase; 5′-UTR, 5′ untranslated region; VNTR, variable number tandem repeat; ENOSF1, enolase superfamily member 1.
Variant | Genotype | No. of patients (n = 100) |
Treatment response |
Chi-square test p-value | |
---|---|---|---|---|---|
Responder | Nonresponder | ||||
5′-UTR–TYMS VNTR | 2R2R | 25 (25.0) | 14 (56.0) | 11 (44.0) | .032a |
2R3R | 54 (54.0) | 36 (66.7) | 18 (33.3) | ||
3R3R | 21 (21.0) | 7 (33.3) | 14 (66.7) | ||
rs2612091 | AA | 29 (29.0) | 15 (51.7) | 14 (48.3) | .017b |
AG | 48 (48.0) | 23 (47.9) | 25 (52.1) | ||
GG | 23 (23.0) | 19 (82.6) | 4 (17.4) | ||
rs2741171 | AA | 16 (16.0) | 11 (68.8) | 5 (31.3) | .065 |
AG | 36 (36.0) | 15 (41.7) | 21 (58.3) | ||
GG | 48 (48.0) | 31 (64.6) | 17 (35.4) |
Values are presented as number (%).
5′-UTR, 5′ untranslated region; TYMS, thymidylate synthetase; VNTR, variable number tandem repeat.
aAmong the studied genotypes, a significant correlation was found between VNTR genotype and treatment response (p = .032). The 2R3R genotype was more common in responders, and the 3R3R genotype was more common among non-responders; bGenotypes of rs2612091 showed a significant association (p = .017), patients who did not respond to treatment showed more frequent AG genotype.
Variant | Genotype |
Survival time (mo) |
HR (95% CI) | p-value | |
---|---|---|---|---|---|
Mean (95% CI) | p-value | ||||
5′-UTR-TYMS VNTR | 2R2R | 23.44 (13.84–33.04) | .003a | 1 (reference group) | - |
2R3R | 39.36 (32.62–46.1) | 0.47 (0.25–0.87) | .020 | ||
3R3R | 47.17 (37.3–57.04) | 0.24 (0.09–0.64) | .005 | ||
rs2612091 | AA | 30.71 (21.37–40.04) | .170 | 1 (reference group) | |
AG | 36.39 (28.97–43.8) | 0.73 (0.39–1.37) | .320 | ||
GG | 45.80 (36.17–55.44) | 0.47 (0.2–1.08) | .080 | ||
rs2741171 | AA | 36.84 (24.62–49.07) | .970 | 1 (reference group) | |
AG | 37.41 (28.93–45.88) | 0.92 (0.39–2.16) | .850 | ||
GG | 36.79 (29.31–44.28) | 1 (0.45–2.23) | .990 |
HR, hazard ratio; CI, confidence interval; 5′-UTR, 5′ untranslated region; TYMS, thymidylate synthetase; VNTR, variable number tandem repeat; 5-FU, 5-fluorouracil.
aThe highest and lowest average survival times of people after 5-FU treatment were in patients with 3R3R and 2R2R genotypes, respectively, and the observed difference was significant (p = .003). Such a different also was observed in the Cox model, where the risk of death in those with 3R3R and 2R3R variants was lower than in those with 2R2R variants (reference group) at 0.24 and 0.47, respectively. The overall survival of patients with rs2612091 or rs2741171 after 5-FU treatment was not significant (p = .170 and p = .970, respectively). In the Cox model, the risk ratio of death in patients with different genotypes of rs2612091 or rs2741171 variants compared to the reference group was not significant (p > .05).
Variant | Genotype |
ENOSF1 expression, n (%) |
p-value | |
---|---|---|---|---|
Low | High | |||
5′-UTR–TYMS VNTR | 2R2R | 25 (100) | 0 | <.001a |
2R3R | 36 (66.7) | 18 (33.3) | ||
3R3R | 0 | 21 (21) | ||
ENOSF1 rs2612091 | GG | 17 (73.9) | 6 (26.1) | .160 |
AG | 36 (75.0) | 12 (25.0) | ||
AA | 16 (25.2) | 13 (44.8) | ||
ENOSF1 rs2741171 | GG | 36 (75.0) | 12 (25.0) | .310 |
AG | 21 (58.3) | 15 (41.7) | ||
AA | 12 (75.0) | 4 (25.0) |
TYMS, thymidylate synthetase; ENOSF1, enolase superfamily member 1; 5′-UTR, 5′ untranslated region; VNTR, variable number tandem repeat.
aThere was a significant relationship between TYMS gene expression and the VNTR variant (p < .001). The 2R2R genotype of the VNTR TYMS variant was associated with low TYMS expression, and the 3R3R genotype of the VNTR TYMS variant was associated with high TYMS expression. There was no significant association between ENOSF1 expression and the investigated genotypes.
OR |
95% CI for OR |
p-value | ||
---|---|---|---|---|
Lower | Upper | |||
ENOSF1 | 5.95 | 2.36 | 15.01 | <.001 |
Gene | Variant | Primer | Product size (bp) | |
---|---|---|---|---|
ENOSF1 | rs2612091 | Forward inner primer (A allele) | CTGGACATCCAGTGGCTCCTCAATCA | 247 |
Reverse inner primer (G allele) | GGTACAGTCTTTAGGAGGAGCCGTGCAC | 197 | ||
Forward outer primer | TGTGCATGATTCAGAATGTGACAAAATGG | 390 | ||
Reverse outer primer | AAAAGAGACTCTTCACAGGGAGGTCAGCC | |||
rs2741171 | Forward inner primer (A allele) | GGGTTTCACCATGTTGATCAGGTGGA | 222 | |
Reverse inner primer (G allele) | GCGGATCACCTGAGGTCAGGAGTATGATAC | 288 | ||
Forward outer primer | CAATTTCCTGCCACAGCCAAAATTTCTC | 454 | ||
Reverse outer primer | TGACTCTCAGAGTGCACAAGCAGCACTT | |||
TYMS | TYMS 28-bp VNTR | Forward primer | CGTGGCTCCTGCGTTTCC | 210 (2R) |
Reverse primer | GAGCCGGCCACAGGCAT | 238 (3R) |
Gene | Variant | Genotype | Frequency, n (%) |
---|---|---|---|
TYMS | 5′-UTR–TYMS VNTR | 2R3R | 54 (54.0) |
2R2R | 25 (25.0) | ||
3R3R | 21 (21.0) | ||
ENOSF1 | rs2612091 | GG | 23 (23.0) |
AG | 48 (48.0) | ||
AA | 29 (29.0) | ||
rs2741171 | GG | 48 (48.0) | |
AA | 16 (16.0) | ||
AG | 36 (36.0) |
Variant | Genotype | No. of patients (n = 100) | Treatment response |
Chi-square test p-value | |
---|---|---|---|---|---|
Responder | Nonresponder | ||||
5′-UTR–TYMS VNTR | 2R2R | 25 (25.0) | 14 (56.0) | 11 (44.0) | .032 |
2R3R | 54 (54.0) | 36 (66.7) | 18 (33.3) | ||
3R3R | 21 (21.0) | 7 (33.3) | 14 (66.7) | ||
rs2612091 | AA | 29 (29.0) | 15 (51.7) | 14 (48.3) | .017 |
AG | 48 (48.0) | 23 (47.9) | 25 (52.1) | ||
GG | 23 (23.0) | 19 (82.6) | 4 (17.4) | ||
rs2741171 | AA | 16 (16.0) | 11 (68.8) | 5 (31.3) | .065 |
AG | 36 (36.0) | 15 (41.7) | 21 (58.3) | ||
GG | 48 (48.0) | 31 (64.6) | 17 (35.4) |
Variant | Genotype | Survival time (mo) |
HR (95% CI) | p-value | |
---|---|---|---|---|---|
Mean (95% CI) | p-value | ||||
5′-UTR-TYMS VNTR | 2R2R | 23.44 (13.84–33.04) | .003 |
1 (reference group) | - |
2R3R | 39.36 (32.62–46.1) | 0.47 (0.25–0.87) | .020 | ||
3R3R | 47.17 (37.3–57.04) | 0.24 (0.09–0.64) | .005 | ||
rs2612091 | AA | 30.71 (21.37–40.04) | .170 | 1 (reference group) | |
AG | 36.39 (28.97–43.8) | 0.73 (0.39–1.37) | .320 | ||
GG | 45.80 (36.17–55.44) | 0.47 (0.2–1.08) | .080 | ||
rs2741171 | AA | 36.84 (24.62–49.07) | .970 | 1 (reference group) | |
AG | 37.41 (28.93–45.88) | 0.92 (0.39–2.16) | .850 | ||
GG | 36.79 (29.31–44.28) | 1 (0.45–2.23) | .990 |
Variant | Genotype | ENOSF1 expression, n (%) |
p-value | |
---|---|---|---|---|
Low | High | |||
5′-UTR–TYMS VNTR | 2R2R | 25 (100) | 0 | <.001 |
2R3R | 36 (66.7) | 18 (33.3) | ||
3R3R | 0 | 21 (21) | ||
ENOSF1 rs2612091 | GG | 17 (73.9) | 6 (26.1) | .160 |
AG | 36 (75.0) | 12 (25.0) | ||
AA | 16 (25.2) | 13 (44.8) | ||
ENOSF1 rs2741171 | GG | 36 (75.0) | 12 (25.0) | .310 |
AG | 21 (58.3) | 15 (41.7) | ||
AA | 12 (75.0) | 4 (25.0) |
Gene | Variant expression | Survival time (mo) |
HR (95% CI) | p-value | |
---|---|---|---|---|---|
Mean (95% CI) | p-value | ||||
TYMS | Low | 1.553 (0.828–2.908) | .218 | 0.633 (0.344–1.167) | .165 |
High | 0.644 (0.343–1.207) | ||||
ENOSF1 | Low | 1.063 (0.540–2.087) | .810 | 1.353 (0.601–3.042) | .464 |
High | 0.941 (0.479–1.849) |
OR | 95% CI for OR |
p-value | ||
---|---|---|---|---|
Lower | Upper | |||
ENOSF1 | 5.95 | 2.36 | 15.01 | <.001 |
The tetra-ARMS polymerase chain reaction (PCR) method was used for
The 2R3R genotype was the most frequent (54.0%) among all cases with 5′-UTR–
Values are presented as number (%). 5′-UTR, 5′ untranslated region; Among the studied genotypes, a significant correlation was found between VNTR genotype and treatment response (p = .032). The 2R3R genotype was more common in responders, and the 3R3R genotype was more common among non-responders; bGenotypes of rs2612091 showed a significant association (p = .017), patients who did not respond to treatment showed more frequent AG genotype.
HR, hazard ratio; CI, confidence interval; 5′-UTR, 5′ untranslated region; The highest and lowest average survival times of people after 5-FU treatment were in patients with 3R3R and 2R2R genotypes, respectively, and the observed difference was significant (p = .003). Such a different also was observed in the Cox model, where the risk of death in those with 3R3R and 2R3R variants was lower than in those with 2R2R variants (reference group) at 0.24 and 0.47, respectively. The overall survival of patients with rs2612091 or rs2741171 after 5-FU treatment was not significant (p = .170 and p = .970, respectively). In the Cox model, the risk ratio of death in patients with different genotypes of rs2612091 or rs2741171 variants compared to the reference group was not significant (p > .05).
There was a significant relationship between
No significant relationship was observed between expression of these genes and the survival time of patients (p = .218 and p = .810, respectively). HR, hazard ratio;
Data analysis showed increased expression of