, Kyung Un Choi1
, Chungsu Hwang
, Hyung Jung Lee
, Jung Hee Lee
, Dong Hoon Shin
, Jee Yeon Kim
, Mee Young Sol
, Jae Ho Kim2
, Ki Hyung Kim3
, Dong Soo Suh3
, Byung Su Kwon3
Department of Pathology, Pusan National University Yangsan Hospital, Yangsan, Korea
1Department of Pathology, Pusan National University Hospital, Busan, Korea
2Department of Physiology, Pusan National University School of Medicine, Busan, Korea
3Department of Obstetrics and Gynecology, Pusan National University Hospital, Busan, Korea
© 2019 The Korean Society of Pathologists/The Korean Society for Cytopathology
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Author Contributions
Conceptualization: SYK, KUC.
Data curation: CH, KHK, DSS, BSK.
Formal analysis: SYK, CH, HJL.
Funding acquisition: KUC, JHK.
Investigation: SYK, KUC, DHS, JYK .
Methodology: SYK, JHL, DHS, JYK, KUC.
Project administration: SYK, KUC, JHK.
Resources: KUC, KHK, DSS, BSK.
Supervision: KUC, JHK.
Validation: DSS, JYK.
Writing—original draft: SYK, KUC.
Writing—review & editing: HJL, JHL, DHS, JHK, MYS.
Conflicts of Interest
The authors declare that they have no potential conflicts of interest.
| Case No. | Histologic type | Stage | Chemotherapy regimen | Period before recurrence (mo) | Response |
|---|---|---|---|---|---|
| 1 | Serous | IIIc | Carbo-Taxola | 4 | Poor response |
| 2 | Serous | IV | Carbo-Taxol | 8 | Poor response |
| 3 | Serous | IIIc | Carbo-Taxol | 4 | Poor response |
| 4 | Serous | IIIc | Carbo-Taxol | 0 | Poor response |
| 5 | Serous | IV | Carbo-Taxol | 1 | Poor response |
| 6 | Serous | IV | Carbo-Taxol | 0 | Poor response |
| 7 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 8 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 9 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 10 | Serous | IIa | Carbo-Taxol | 38 | Good response |
| 11 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 12 | Serous | IV | Carbo-Taxol | 25 | Good response |
| Gene | Sequence (5'-3') |
|---|---|
| Cluster of differentiation 109 | |
| Forward | GAAGCCATCTCTCAACTTCACA |
| Reverse | CTCCTTGGAGGCCATGTG |
| GAPDH | |
| Forward | GAAGGTGGTGAAGCAGGC |
| Reverse | TTCCACTGTTAGATCCGCTCC |
| Parameter | Negative | Positive | p-valuea |
|---|---|---|---|
| Histologic type | .000 | ||
| Serous | 13 (22.0) | 46 (78.0) | |
| Mucinous | 19 (86.4) | 3 (13.6) | |
| Endometrioid | 3 (33.3) | 6 (66.7) | |
| Clear cell | 22 (81.5) | 5 (18.5) | |
| Undifferentiated | 0 (0) | 3 (100) | |
| Histologic grade | .012 | ||
| Well differentiated | 19 (67.9) | 9 (32.1) | |
| Moderate differentiated | 29 (47.5) | 32 (52.5) | |
| Poorly differentiated | 9 (29.0) | 22 (71.0) | |
| Nuclear grade | .788 | ||
| I | 3 (50.0) | 3 (50.0) | |
| II | 29 (44.6) | 36 (55.4) | |
| III | 25 (51.0) | 24 (49.0) | |
| FIGO stage | .000 | ||
| I | 39 (76.5) | 12 (23.5) | |
| II, III and IV | 18 (26.1) | 51 (73.9) | |
| Mitoses (per 10HPFs) | .000 | ||
| 1–9 | 32 (71.1) | 13 (28.9) | |
| ≥ 10 | 25 (33.3) | 50 (66.7) |
| Parameter | Negative | Positive | p-valuea |
|---|---|---|---|
| Histologic grade | .351 | ||
| Well differentiated | 2 (40.0) | 3 (60.0) | |
| Moderate differentiated | 9 (24.3) | 28 (75.7) | |
| Poorly differentiated | 2 (11.8) | 15 (88.2) | |
| Nuclear grade | .850 | ||
| I | 0 (0) | 1 (100) | |
| II | 8 (21.6) | 29 (78.4) | |
| III | 5 (23.8) | 16 (76.2) | |
| FIGO stage | .004 | ||
| I | 7 (53.8) | 6 (46.2) | |
| II, III and IV | 6 (13.0) | 40 (87.0) | |
| Mitoses (per 10HPFs) | .959 | ||
| 1–9 | 3 (25.0) | 9 (75.0) | |
| 10–19 | 5 (21.7) | 18 (78.3) | |
| ≥ 20 | 5 (20.8) | 19 (79.2) |
| Parameter |
CD109 expression |
|
|---|---|---|
| Negative | Positive | |
| Good response group | 7 (33.3) | 14 (66.7) |
| Poor response group | 1 (12.5) | 15 (93.8) |
PubReader
ePub Link
Cite this Article
| No. (%) (n = 120) | |
|---|---|
| Follow-up, median (range, mo) | 50 (1–115) |
| Age at diagnosis (yr) | 51 (15–82) |
| < 50 | 57 (47.5) |
| ≥ 50 | 63 (52.5) |
| Histologic type | |
| Serous | 59 (49.2) |
| Mucinous | 22 (18.3) |
| Endometrioid | 9 (7.5) |
| Clear cell | 27 (22.5) |
| Undifferentiated | 3 (2.5) |
| Histologic grade | |
| Well differentiated | 28 (23.3) |
| Moderate differentiated | 61 (50.8) |
| Poorly differentiated | 31 (25.8) |
| Nuclear grade | |
| I | 6 (5.0) |
| II | 65 (54.2) |
| III | 49 (40.8) |
| FIGO stage | |
| I | 51 (42.5) |
| II | 6 (5) |
| III | 44 (36.7) |
| IV | 19 (15.8) |
| Mitosis (per 10HPFs) | |
| 1–9 | 45 (37.5) |
| 10–19 | 41 (34.2) |
| ≥ 20 | 34 (28.3) |
| Overall survival | |
| Survival | 63 (52.5) |
| Death | 57 (47.5) |
| Recurrence | |
| Absent | 27 (22.5) |
| Present | 93 (77.5) |
| Case No. | Histologic type | Stage | Chemotherapy regimen | Period before recurrence (mo) | Response |
|---|---|---|---|---|---|
| 1 | Serous | IIIc | Carbo-Taxol |
4 | Poor response |
| 2 | Serous | IV | Carbo-Taxol | 8 | Poor response |
| 3 | Serous | IIIc | Carbo-Taxol | 4 | Poor response |
| 4 | Serous | IIIc | Carbo-Taxol | 0 | Poor response |
| 5 | Serous | IV | Carbo-Taxol | 1 | Poor response |
| 6 | Serous | IV | Carbo-Taxol | 0 | Poor response |
| 7 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 8 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 9 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 10 | Serous | IIa | Carbo-Taxol | 38 | Good response |
| 11 | Serous | IIIc | Carbo-Taxol | No recur | Good response |
| 12 | Serous | IV | Carbo-Taxol | 25 | Good response |
| Gene | Sequence (5'-3') |
|---|---|
| Cluster of differentiation 109 | |
| Forward | GAAGCCATCTCTCAACTTCACA |
| Reverse | CTCCTTGGAGGCCATGTG |
| GAPDH | |
| Forward | GAAGGTGGTGAAGCAGGC |
| Reverse | TTCCACTGTTAGATCCGCTCC |
| Parameter | Negative | Positive | p-value |
|---|---|---|---|
| Histologic type | .000 | ||
| Serous | 13 (22.0) | 46 (78.0) | |
| Mucinous | 19 (86.4) | 3 (13.6) | |
| Endometrioid | 3 (33.3) | 6 (66.7) | |
| Clear cell | 22 (81.5) | 5 (18.5) | |
| Undifferentiated | 0 (0) | 3 (100) | |
| Histologic grade | .012 | ||
| Well differentiated | 19 (67.9) | 9 (32.1) | |
| Moderate differentiated | 29 (47.5) | 32 (52.5) | |
| Poorly differentiated | 9 (29.0) | 22 (71.0) | |
| Nuclear grade | .788 | ||
| I | 3 (50.0) | 3 (50.0) | |
| II | 29 (44.6) | 36 (55.4) | |
| III | 25 (51.0) | 24 (49.0) | |
| FIGO stage | .000 | ||
| I | 39 (76.5) | 12 (23.5) | |
| II, III and IV | 18 (26.1) | 51 (73.9) | |
| Mitoses (per 10HPFs) | .000 | ||
| 1–9 | 32 (71.1) | 13 (28.9) | |
| ≥ 10 | 25 (33.3) | 50 (66.7) |
| Parameter | Negative | Positive | p-value |
|---|---|---|---|
| Histologic grade | .351 | ||
| Well differentiated | 2 (40.0) | 3 (60.0) | |
| Moderate differentiated | 9 (24.3) | 28 (75.7) | |
| Poorly differentiated | 2 (11.8) | 15 (88.2) | |
| Nuclear grade | .850 | ||
| I | 0 (0) | 1 (100) | |
| II | 8 (21.6) | 29 (78.4) | |
| III | 5 (23.8) | 16 (76.2) | |
| FIGO stage | .004 | ||
| I | 7 (53.8) | 6 (46.2) | |
| II, III and IV | 6 (13.0) | 40 (87.0) | |
| Mitoses (per 10HPFs) | .959 | ||
| 1–9 | 3 (25.0) | 9 (75.0) | |
| 10–19 | 5 (21.7) | 18 (78.3) | |
| ≥ 20 | 5 (20.8) | 19 (79.2) |
| Variable | Hazard ratio | 95% confidence interval | p-value |
|---|---|---|---|
| Histologic grade | |||
| Well differentiated | 1 | ||
| Moderate differentiated | 0.33 | 0.12–0.87 | .020 |
| Poorly differentiated | 0.63 | 0.34–1.14 | .130 |
| FIGO stage | |||
| I | 1 | ||
| II, III, and IV | 0.17 | 0.07–0.38 | < .001 |
| CD109 expression | |||
| Negative | 0 | ||
| Positive | 1.58 | 0.82–3.05 | .160 |
| Variable | Hazard ratio | 95% confidence interval | p-value |
|---|---|---|---|
| Histologic grade | |||
| Well differentiated | 1 | ||
| Moderate differentiated | 0.34 | 0.09–1.26 | .220 |
| Poorly differentiated | 0.53 | 0.21–1.32 | .100 |
| FIGO stage | |||
| I | 1 | ||
| II, III, and IV | 1.29 | 0.41–0.41 | < .001 |
| CD109 expression | |||
| Negative | 1 | ||
| Positive | 2.06 | 0.83–5.09 | .110 |
| Parameter | CD109 expression |
|
|---|---|---|
| Negative | Positive | |
| Good response group | 7 (33.3) | 14 (66.7) |
| Poor response group | 1 (12.5) | 15 (93.8) |
FIGO, International Federation of Gynecology and Obstetrics; HPF, high-power field.
Pacilitaxel and carboplatin.
GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells. FIGO, Federation of Gynecology and Obstetrics; HPF, high power field. Pearson’s chi-squared test.
Values are presented as number (%). FIGO, Federation of Gynecology and Obstetrics; HPF, high power field; Negative, less than 10% positive staining of tumor cells; Positive, more than 10% positive staining of tumor cells. Pearson’s chi-squared test.
Values are presented as number (%).